Instructions to use Xenova/nucleotide-transformer-500m-human-ref with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- Transformers.js
How to use Xenova/nucleotide-transformer-500m-human-ref with Transformers.js:
// npm i @huggingface/transformers import { pipeline } from '@huggingface/transformers'; // Allocate pipeline const pipe = await pipeline('feature-extraction', 'Xenova/nucleotide-transformer-500m-human-ref');
https://huggingface.co/InstaDeepAI/nucleotide-transformer-500m-human-ref with ONNX weights to be compatible with Transformers.js.
Usage (Transformers.js)
If you haven't already, you can install the Transformers.js JavaScript library from NPM using:
npm i @huggingface/transformers
Example: Retrieve embeddings from a dummy DNA sequence.
import { pipeline } from '@huggingface/transformers';
// Create feature extraction pipeline
const extractor = await pipeline('feature-extraction', 'Xenova/nucleotide-transformer-500m-human-ref', {
dtype: "fp32" // Options: "fp32", "fp16", "q8", "q4"
});
// Perform feature extraction
const sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"];
const output = await extractor(sequences, { pooling: 'mean' });
console.log(output);
// Tensor {
// dims: [ 2, 1280 ],
// type: 'float32',
// data: Float32Array(2560) [ -0.4544594883918762, 0.33294573426246643, ... ],
// size: 2560
// }
You can convert the output Tensor to a nested JavaScript array using .tolist():
console.log(output.tolist());
// [
// [ -0.4544594883918762, 0.33294573426246643, -0.06337763369083405, ... ],
// [ 0.05060688406229019, -0.21165050566196442, -0.32883304357528687, ... ]
// ]
Note: Having a separate repo for ONNX weights is intended to be a temporary solution until WebML gains more traction. If you would like to make your models web-ready, we recommend converting to ONNX using 🤗 Optimum and structuring your repo like this one (with ONNX weights located in a subfolder named onnx).
- Downloads last month
- 12